Supplemental information for

Caenorhabditis elegans has scores of hedgehog related genes: sequence and expression analysis

Gudrun Aspöck, Hiroshi Kagoshima, Gisela Niklaus, and Thomas R. Bürglin

Additional sequence alignment figure

Complete alignment of the predicted protein sequences of Grd-1, Grd-2, and Grd-11. Identical residues are highlighted in yellow, boxes indicate the four Ground domains, the Hog domains are underlined with dashes. Conserved cysteine residues are highlighted by , two stars mark the positions in Grd-11, where two cysteine residues are not conserved. Intron positions are indicated by arrowheads.
Note: Within the Hog domain Grd-11 has an insertion of an extra exon. This position can apparently accommodate extra amino acids, as exemplified by human Shh, which has also more residues in that region than other Hog genes (Fig. 1A). If one attempts to force a different splicing that omits this extra exon, the splice junction creates a premature stop codon. This indicates that the extra exon may have been fortuitously incorporated to bypass the stop codon. Another interesting feature of Grd-11 is that in the fourth Ground domain two conserved cysteine residues have been replaced by other residues (marked by stars).
 

Chromsomal distribution figure

Chromosomal distribution of the wrt, grd, and grl genes. Gene positions are indicated by lines, the length of the line represents the number of genes at that location. Three different columns were generated, one each for wrt, grd and grl genes. The numbers indicate the gene name, i.e. 1 in the wrt column denotes wrt-1.

Table with list of all genes, indicating gene name, gene family, chromosome location, cosmids, accession numbers, cDNAs
 

Materials and Methods:
For generating the different reporter constructs, the following oligonucleotide primers were used for PCR:

wrt1-3, AACGCGTCGACATCCAGAAGCCACTCAATCCACAGC;
wrt1-6, ACCTTTGGGTCCTTTGGCCAATCCCCGGCAAGAAAAGTTGCAGTTAATGGG;
wrt2-1, CAGGTCGACTCCAGGTAATTTCACAACATCCGGG;
wrt2-5, ACCTTTGGGTCCTTTGGCCAATCCCAGGAATATGATCGGCGTATGCATCCG;
wrt3-1, TGCTCTAGATTCCTGCGAACGCCAGAAGATTCCC;
wrt3-2, CGCGGATCCCAACATATTGTTAGAATTGAAATGG;
wrt4-1, CTTTGGGTCCTTTGGCCAATCCCTCATTGTATCTGAACAAATTCAAGAC;
wrt4-2, GCTCTAGAGGAGCCTAAACAAGCATTCTCATG;
wrt4-3, CGCGGATCCCCTCATTGTATCTGAACAAATTCAAGAC;
wrt5-1, CGGAGTCGTTAGCGTACTTTTGCCG;
wrt5-6, CTTTGGGTCCTTTGGCCAATCCCATGGTGGTCGGATGCTGAAACTTTG;
wrt5-9, CGCGGATCCCATGGTGGTCGGATGCTGAAACTTTG;
wrt6-6, TCATTCGGACTGTGTAATTTAGCCAG;
wrt6-7, CGCGGATCCGAGTAATGTCATTTTGGAAACAGAACAGCATAC;
wrt7-3, TGCTCTAGATATGAATGGCAAAATGGGGTGTC;
wrt7-2, CGCGGATCCTGAAATGTTCATTTTTGTTCTCTGAAAC;
wrt8-4, AACTGCAGCTCCTCCCTGTGCCACAACTGATCC;
wrt8-3, CGCGGATCCTGGCGTCATCTATGATCGGGCGGTG;
grd1-1, GTCCTGCAGTTCGTCGATGAATTTTTGGAGCACG;
grd1-2, CCTTTGGGTCCTTTGGCCAATCCCTAAGCTTGGAAAGTTCTTCATCGCAAC;
grd1-3, CCTTTGGGTCCTTTGGCCAATCCCTGCTTTGAAAATATTCATTAAATACTAC;
grd2-1, CACGTGGCATGCGATCCACGAAGAGACGGAGAGTGGTG;
grd2-3, CCTTTGGGTCCTTTGGCCAATCCCCTCCATCTGTGCACGTCTTTGAAC;
grd3-1, ATCGAGTCGACGAATAACGACACCCTTGGCCCCAG;
grd3-2, CCTTTGGGTCCTTTGGCCAATCCCGGGTCTGCATTCCGGTCTCCACGAC;
grd3-3, CCTTTGGGTCCTTTGGCCAATCCCCATCGCTGCCGAGCTGAACACTGATC;
grd5-1, TTTGGATCCAGGTGCCTTCCATTGGCTTTCCTTC;
grd5-2, CCTTTGGGTCCTTTGGCCAATCCCCCATGGCTCCTTTCATGGCTGACTCG;
grd5-3, CCTTTGGGTCCTTTGGCCAATCCCCATTTCTGAGGAGTCTGCAAGGAGG;
grd6-1, GTCGGATCCGACATCCCATGTGGCATACAACCGC;
grd6-2, CCTTTGGGTCCTTTGGCCAATCCCCTGAATGCTTTTGCAGTTTGGTTGC;
grd6-3, CCTTTGGGTCCTTTGGCCAATCCCCGGCATCGTGATCCGAATTGTGACTG;
grd7-1, TGTGGATCCGTTCTTCGCTTGCTGGCACTGGTCC;
grd7-2, CCTTTGGGTCCTTTGGCCAATCCCTCGCTGGATATGGCTGAGGCTCCTCG;
grd7-3, CCTTTGGGTCCTTTGGCCAATCCCCGGCATCATATCGACTAAAGCGTCTG;
grd8-1, ATAGGATCCATTCTGCTGTCACACTTGCACCCG;
grd8-2, CCTTTGGGTCCTTTGGCCAATCCCAGCAAAGGAATCCCGACGGGTTCG;
grd9-1, CAAGGATCCATTGTGAAAGTGCAGCTGTGCTTGG;
grd9-2, CCTTTGGGTCCTTTGGCCAATCCCTTCGTTCACTGGCACGTTGAACCTTG;
grd9-3, CCTTTGGGTCCTTTGGCCAATCCCCATTAAAATGAACTCCCACATTGGG;